ارزیابی برخی شاخص¬های زیستی عروس¬ماهی زاینده¬رود Petroleuciscus esfahani در پاسخ به ترکیبات مخرب سیستم اندوکراینی در رودخانه زاینده¬رود- قسمت ۲۱

slVTG5’RACE-R3

 

 

معکوس

 

 

TTCCAACCACACCATTAGCA

 

 

۳۶۶ a

 

 

 

slβactin5’RACE-R1

 

 

معکوس

 

 

GGCACCTGAACCTCTCATTG

 

 

۸۶۷ b

 

 

 

slβactin5’RACE-R2

 

 

معکوس

 

 

GAGCTTCTCCTTGATGTCACG

 

 

۷۴۳ b

 

 

 

QPCR

 

 

slQVTG-F3

 

 

مستقیم

 

 

GAATGCACAAAGAGGGTCAAG

 

 

۶۳۰ a

 

 

 

slQVTG-R3

 

 

معکوس

 

 

TTGAAGGGTGAAAACTGATGC

 

 

۷۵۷ a

 

 

 

slQβactin-F3

 

 

مستقیم

 

 

CCTGTTCCAGCCATCCTTCT

 

 

۸۷۵ b

 

 

 

slQβactin-R3

 

 

معکوس

 

 

TGGTACCACCAGACAATACGG

 

 

۱۰۰۵ b

 

 

a موقعیت نسبت بهcDNA کامل ویتلوژنین درP. esfahani.
b موقعیت نسبت به cDNA کامل بتا-اکتین درP. esfahani.
۳-۹- مقایسات آماری
داده های آماری به صورت میانگین ± خطای استاندارد گزارش شدند. کلیه محاسبات آماری با بهره گرفتن از دو نرم افزار SPSS 19 و Microsoft Office Excel 2010 انجام شد. پس از اطمینان از توزیع نرمال داده ها و یکنواختی واریانس ها[۱۱۸] از آزمون تجزیه واریانس یک­طرفه[۱۱۹] برای مقایسه واریانس شاخص ­های موردنظر در هر ایستگاه و از آزمون چند دامنه دانکن[۱۲۰] در سطح ۰۵/۰ برای بررسی وجود یا عدم وجود اختلاف معنی­دار بین ایستگاه­ها استفاده شد. همچنین در هر ایستگاه برای مشخص کردن وجود یا عدم وجود انحراف نسبت جنسی از نسبت مورد انتظار، از آزمون مربع کای[۱۲۱] استفاده شد.
فصل چهارم
نتایج و بحث
۴-۱- شاخص ­های زیستی ماهیان صید شده
در این مطالعه در مجموع تعداد ۳۲۳ قطعه ماهی صید شد. از این تعداد، ۱۰۴ قطعه متعلق به ایستگاه چشمه­دیمه، ۸۱ قطعه متعلق به ایستگاه خرسونک، ۶۳ قطعه متعلق به ایستگاه چمگردان و ۷۵ عدد متعلق به ایستگاه پل صفائیه بود. دامنه سنی ماهیان در ایستگاه­ چشمه­دیمه ۱-۵ سال و در سه ایستگاه خرسونک، پل صفائیه و چمگردان ۳-۵ سال بود. تعداد ماهیان صید شده از هر ایستگاه به تفکیک جنسیت در جدول ۴-۱ مشاهده می­ شود.
در ماهیان صید شده از ایستگاه چشمه­دیمه، خرسونک، پل صفائیه و چمگردان میانگین وزنی به ترتیب ۳۱/۱ ± ۱۳/۱۸، ۳۴/۱ ± ۸۵/۲۵، ۱۳/۱ ± ۸۷/۴ و ۵۰/۰ ± ۷۶/۱۰ گرم و میانگین طولی به ترتیب ۳ ± ۱۰۷، ۲ ± ۱۱۸، ۴ ± ۶۹ و ۱ ± ۹۱ میلی­متر محاسبه شد (جدول ۴-۱). همان­طور که مشاهده می­ شود، اختلاف طول و وزن ماهیان در بین تمام ایستگاه­ها معنی­دار است (۰۵/۰p<). بیش­ترین و کم­ترین میزان میانگین طول و وزن ماهیان به ترتیب در ایستگاه­های خرسونک و چمگردان مشاهده شد.
جدول ۴-۱) ویژگی­های زیستی ماهیان صید شده در ایستگاه­های نمونه­برداری رودخانه زاینده­رود.

 

برای دانلود متن کامل پایان نامه به سایت tinoz.ir مراجعه کنید.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Be the first to comment

Leave a Reply

ایمیل شما نمایش داده نخواهد شد


*